Malformations of cortical development: Fetal imaging and genetics.

BACKGROUND: Malformations of cortical development (MCD) are a group of congenital disorders characterized by structural abnormalities in the brain cortex. The clinical manifestations include refractory epilepsy, mental retardation, and cognitive impairment. Genetic factors play a key role in the etiology of MCD. Currently, there is no curative treatment for MCD. Phenotypes such as epilepsy and cerebral palsy cannot be observed in the fetus. Therefore, the diagnosis of MCD is typically based on fetal brain magnetic resonance imaging (MRI), ultrasound, or genetic testing. The recent advances in neuroimaging have enabled the in-utero diagnosis of MCD using fetal ultrasound or MRI. METHODS: The present study retrospectively reviewed 32 cases of fetal MCD diagnosed by ultrasound or MRI. Then, the chromosome karyotype analysis, single nucleotide polymorphism array or copy number variation sequencing, and whole-exome sequencing (WES) findings were presented. RESULTS: Pathogenic copy number variants (CNVs) or single-nucleotide variants (SNVs) were detected in 22 fetuses (three pathogenic CNVs [9.4%, 3/32] and 19 SNVs [59.4%, 19/32]), corresponding to a total detection rate of 68.8% (22/32). CONCLUSION: The results suggest that genetic testing, especially WES, should be performed for fetal MCD, in order to evaluate the outcomes and prognosis, and predict the risk of recurrence in future pregnancies.

High burden of human papillomavirus infection among men in Guangzhou, South China: Implications for HPV vaccination strategies.

The epidemiological and clinical aspects of Human Papillomavirus (HPV) infection in women have been extensively studied. However, there is a lack of information regarding HPV characteristics in males. In this study, we conducted a retrospective and observational study of 3737 consecutive male individuals attending outpatient clinics of Guangdong Women and Children Hospital from 2012 to 2023 in Guangzhou, South China, to determine the age- and genotype-specific prevalence of HPV in men. The results showed the overall prevalence of HPV among men was 42.15% (1575/3737), with variations ranging from 29.55% to 81.31% across distinct diagnostic populations. Low-risk HPV6 (15.47%), HPV11 (8.94%), and high-risk HPV52 (5.51%) were the most common types. The annual HPV prevalence decreased significantly (Z = -3.882, p < .001), ranging from 31.44% to 52.90%. 28.77% (1075/3737) of men manifested infection with a singular HPV type, predominantly identified as a low-risk type. The age-specific distribution of HPV infections revealed distinctive peaks in the < 25 y age group (47.60%, 208/437) and the 40-44 y age group (44.51%, 154/346). Notably, the positive rate of Chlamydia trachomatis was significantly higher among HPV-positive individuals in comparison to HPV-negatives (16.14% vs. 11.25%, p < .05). Our findings reveal a substantial prevalence of HPV infection among outpatient men in Guangzhou, South China. It is recommended to consider the inclusion of HPV vaccination for adolescent males in national immunization schedules, once an adequate supply of vaccines is accessible.

Deep metagenomic characterization of the gut virome in pregnant women with preeclampsia.

Preeclampsia (PE), a pregnancy-specific syndrome, has been associated with the gut bacteriome. Here, to investigate the impact of the gut virome on the development of PE, we identified over 8,000 nonredundant viruses from the fecal metagenomes of 40 early-onset PE and 37 healthy pregnant women and profiled their abundances. Comparison and correlation analysis showed that PE-enriched viruses frequently connected to Blautia species enriched in PE. By contrast, bacteria linked to PE-depleted viruses were often the Bacteroidaceae members such as Bacteroides spp., Phocaeicola spp., Parabacteroides spp., and Alistipes shahii. In terms of viral function, PE-depleted viruses had auxiliary metabolic genes that participated in the metabolism of simple and complex polysaccharides, sulfur metabolism, lipopolysaccharide biosynthesis, and peptidoglycan biosynthesis, while PE-enriched viruses had a gene encoding cyclic pyranopterin monophosphate synthase, which seemed to be special, that participates in the biosynthesis of the molybdenum cofactor. Furthermore, the classification model based on gut viral signatures was developed to discriminate PE patients from healthy controls and showed an area under the receiver operating characteristic curve of 0.922 that was better than that of the bacterium-based model. This study opens up new avenues for further research, providing valuable insights into the PE gut virome and offering potential directions for future mechanistic and therapeutic investigations, with the ultimate goal of improving the diagnosis and management of PE.IMPORTANCEThe importance of this study lies in its exploration of the previously overlooked but potentially critical role of the gut virome in preeclampsia (PE). While the association between PE and the gut bacteriome has been recognized, this research takes a pioneering step into understanding how the gut virome, represented by over 8,000 nonredundant viruses, contributes to this condition. The findings reveal intriguing connections between PE-enriched viruses and specific gut bacteria, such as the prevalence of Blautia species in individuals with PE, contrasting with bacteria linked to PE-depleted viruses, including members of the Bacteroidaceae family. These viral interactions and associations provide a deeper understanding of the complex dynamics at play in PE.

Emergence and circulation of enterovirus B species in infants in southern China: A multicenter retrospective analysis.

BACKGROUND: Enteroviruses (EV) are common and can cause severe diseases, particularly in young children. However, the information of EV infection in infants in China is limited due to the vast population size and extensive geographical area of the country. Here, we conducted a retrospective multicenter analysis of available EV data to assess the current epidemiological situation in the infant population in southern China. METHODS: The study enrolled infants with suspected EV infection from 34 hospitals across 12 cities in southern China between 2019 to 2022, and the confirmation of EV was done using RT-PCR and VP1 gene sequencing. RESULTS: Out of 1221 infants enrolled, 330 (27.03%) were confirmed as EV-infected. Of these, 260 (78.79%) were newborns aged 0-28 days. The EV belonged to three species: EV-B (80.61%), EV-A (11.82%), and human rhinovirus (7.58%). Newborns were more susceptible to EV-B than older infants (p < 0.001). Within EV-B, we identified 15 types, with coxsackievirus (CV) B3 (20.91%), echovirus (E) 11 (19.70%), and E18 (16.97%) being the most common. The predominant EV types changed across different years. EV infection in infants followed a seasonal pattern, with a higher incidence from May to August. Furthermore, perinatal mother-to-child EV transmission in 12 mother-newborn pairs were observed. CONCLUSION: Our study is the first to demonstrate the emergence and widespread circulation of EV-B species, mainly CVB3, E11, and E18, in southern China, primarily affecting young infants. This research provides valuable insights for future epidemic assessment, prediction, as well as the elimination of mother-to-child transmission.

Two novel deletion mutations in ß-globin gene cause ß-thalassemia trait in two Chinese families.

BACKGROUND: ß-Thalassemia is mainly caused by point mutations in the ß-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. RESULTS: In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed ßCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed ßCD128-134) in family A and B, respectively. Both the two novel mutations lead to ß-thalassemia trait. However, when compounded with other ß0-thalassemia, it may behave with ß-thalassemia intermedia or ß-thalassemia major. CONCLUSION: Our study broadens the variants spectral of ß-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

Epigenetic phenotype of plasma cell-free DNA in the prediction of early-onset preeclampsia.

BACKGROUND: In the current study, we sought to characterise the methylation haplotypes and nucleosome positioning patterns of placental DNA and plasma cell-free DNA of pregnant women with early-onset preeclampsia using whole genome bisulphite sequencing (WGBS) and methylation capture bisulphite sequencing (MCBS) and further develop and examine the diagnostic performance of a generalised linear model (GLM) by incorporating the epigenetic features for early-onset preeclampsia. METHODS: This case-control study recruited pregnant women aged at least 18 years who delivered their babies at our Hospital. In addition, non-pregnant women with no previous history of diseases were included. Placental samples of the villous parenchyma were taken at the time of delivery and venous blood was drawn from pregnant women during non-invasive prenatal testing at 12-15 weeks of pregnancy and nonpregnant women during the physical check-up. WGBS and MCBS were carried out of extracted genomic DNA. Then, we established the GLM by incorporating preeclampsia-specific methylation haplotypes and nucleosome positioning patterns and examined the diagnostic performance of the model by receiver operating characteristic (ROC) curve analysis. RESULTS: The study included 135 pregnant women and 50 non-pregnant women. Our high-depth MCBS revealed notably different DNA methylation and nucleosome positioning patterns between women with and without preeclampsia. Preeclampsia-specific hypermethylated sites were found predominantly in the promoter regions and particularly enriched in CTCF on the X chromosome. Totally, 2379 preeclampsia-specific methylation haplotypes were found across the entire genome. ROC analysis showed that the area under the ROC curve (AUC) was 0.938 (95%CI 0.877, 1.000). At a GLM cut-off of 0.341, the AUC was the maximum, with a sensitivity of 95.6% and a specificity of 89.7%. CONCLUSION: Pregnant women with early-onset preeclampsia exhibit DNA methylation and nucleosome positioning patterns in placental and plasma DNA.

Early-onset preeclampsia is a potentially dangerous condition that can have a profound impact on the health of both the expectant mother and her unborn child. This condition is particularly concerning because it's challenging to predict who may be affected using conventional methods such as monitoring blood pressure. In our research, we've developed an innovative, non-invasive approach to predict the onset of early preeclampsia. We do this by analysing the genetic material of the developing baby, which can be found in the mother's blood. Our method has shown remarkable accuracy in our testing populations, and its implications are substantial. By providing an early warning system, this breakthrough can benefit pregnant women immensely. It means that early-onset preeclampsia can be identified and addressed well before it becomes a serious health threat. This allows for timely medical interventions and treatments, significantly improving the well-being of both mothers and their precious little ones.

Intrauterine phenotype features of fetuses with 7q11.23 microduplication syndrome.

OBJECTIVE: To share our experience on prenatal diagnosis of 7q11.23 microduplication syndrome and to further delineate the fetal phenotypes of the syndrome. METHODS: A retrospective study was conducted to evaluate seven cases of dup7q11.23 syndrome diagnosed prenatally by chromosomal microarray (CMA). Clinical data were reviewed, including maternal characteristics, indications for prenatal diagnosis, sonographic findings, CMA results, pregnancy outcomes and follow-ups. RESULTS: Seven cases, including 2 pairs of MCDA twins, were prenatally identified with dup7q11.23 syndrome. The most common prenatal sonographic features were ventriculomegaly, low-lying conus medullaris, and dilated ascending aorta. All 7 fetuses presented with typical 7q11.23 duplications (1.40-1.55 Mb). Parental chromosome analysis was performed in four pairs of parents, and indicated that the duplications of Case 6 and 7 were inherited from their asymptomatic mother. CONCLUSION: Our case series suggest that prenatal features of dup7q11.23 cases are diversified, with ventriculomegaly and low-lying conus medullaris being the most common intrauterine phenotypes. Additionally, cleft palate, dilated ascending aorta, and renal abnormalities were also observed, and should be taken into consideration in subsequent studies.

When NIPT meets WES, prenatal diagnosticians face the dilemma: genetic etiological analysis of 2,328 cases of NT thickening and follow-up of pregnancy outcomes.

Objective: To assess the performance of diverse prenatal diagnostic approaches for nuchal translucency (NT) thickening and to investigate the optimal prenatal screening or diagnostic action with a NT thickening of 95th percentile-3.50 mm. Methods: A retrospective analysis of 2,328 pregnancies with NT ≥ 95th percentile through ultrasound-guided transabdominal chorionic villus sampling (CVS), amniocentesis, or cordocentesis obtained clinical samples (chorionic villi, amniotic fluid, and cord blood), and real-time quantitative fluorescent PCR (QF-PCR), chromosome karyotyping (CS), chromosome microarray analysis (CMA), or whole exome sequencing (WES) were provided to identify genetic etiologies. Results: In this study, the incidence of chromosomal defects increased with NT thickness. When NT ≥ 6.5 mm, 71.43% were attributed to genetic abnormalities. The 994 gravidas with fetal NT thickening underwent short tandem repeat (STR), CS, and CMA. In 804 fetuses with normal karyotypes, CMA detected 16 (1.99%) extra pathogenic or likely pathogenic copy number variations (CNVs). The incremental yield of CMA was only 1.16% (3/229) and 3.37% (10/297) in the group with NT 95th percentile-2.99 mm and NT 3.0-3.49 mm, separately. Among the 525 gravidas with fetal NT thickening who underwent STR, CMA, and WES, the incremental yield of WES was 4.09% (21/513). In the group of NT 95th percentile-2.99 mm, there were no additional single-nucleotide variations (SNVs) detected in WES, while in 143 cases with NT of 3.0-3.49 mm, the incremental yield of WES was 5.59% (8/143). Conclusion: In the group of NT 95th percentile-3.0 mm, since chromosomal aneuploidy and chromosomal copy number variation were the primary causes and the additional contribution of CMA and WES was not significant, we recommend NIPT-Plus for pregnant women with a NT thickening of 95th percentile-3.0 mm first. In addition, comprehensive prenatal genetic testing involving CMA and WES can benefit pregnancies with NT thickening of 3.0-3.49 mm.

Association between cell-free DNA fetal fraction and pregnant character: a retrospective cohort study of 27,793 maternal plasmas.

To determine the association between cell-free DNA fetal fraction (cffDNA) and various prenatal characters to better guide the clinical application of noninvasive prenatal screening (NIPS), a retrospective cohort study of 27,793 women with singleton pregnancies was conducted. Results indicated that no significant difference on cffDNA between trisomy/sex chromosome aneuploidy (SCA) and non-trisomy groups was found. However, the fetal fraction (FF) in the T18 and T13 subgroups were significantly lower than that in the non-trisomy group, while the FF in the T21 group was significantly higher than the non-trisomy group. Pearson's correlation analysis revealed a positive correlation between √FF and gestational week in the T21, SCA, and non-trisomy groups. A negative correlation between maternal age and √FF in T21 and non-trisomy cases was found, but a positive correlation in SCA group. Compared to the decreasing trend in FF in the T21 group, no significant difference was observed in the SCA group. The √FF level was negatively correlated to maternal BMI in T21 and non-trisomy group, while a positive correlation in SCA group. FF was close related to the result of NIPS and related maternal factors. Though NIPS has increased accuracy, the complexity still should be recognized especially in clinical practice.

Prenatal phenotype features and genetic etiology of the Williams-Beuren syndrome and literature review.

Objective: To share our experience on prenatal diagnosis of Williams-Beuren syndrome(WBS) and to improve the awareness, diagnosis, and intrauterine monitoring of the fetuses of this disease. Methods: The study retrospectively evaluated 14 cases of WBS diagnosed prenatally by single nucleotide polymorphism array (SNP-array). Clinical data from these cases were systematically reviewed, including maternal demographics, indications for invasive prenatal diagnosis, ultrasound findings, SNP-array results, trio-medical exome sequencing (Trio-MES) results, QF-PCR results, pregnancy outcomes and follow-ups. Results: A total of 14 fetuses were diagnosed with WBS and their prenatal phenotypes were assessed retrospectively. In our case series, the most common ultrasound features were intrauterine growth retardation (IUGR), congenital cardiovascular defects, abnormal fetal placental doppler indices, thickened nuchal translucency(NT) and polyhydramnios. Other less common ultrasound features include fetal hydrops, hydroderma, bilateral pleural effusion, subependymal cysts, etc. Parental chromosome analysis was performed in seven pairs of parents, and all the deletions on chromosome 7q11.23 were de novo. Conclusion: Prenatal ultrasound features of WBS cases are highly variable, with IUGR, cardiovascular abnormalities and abnormal fetal placental doppler indices, being the most common intrauterine phenotypes. Our case series expand the intrauterine phenotypes of WBS, including cardiovascular abnormalities right aortic arch(RAA) combined with persistent right umbilical vein(PRUV) and elevated the ratio of end-systolic peak flow velocity to end-diastonic peak flow velocity(S/D). In the meantime, with the decrease in the cost of the next-generation sequencing, the method may become widely used in prenatal diagnosis in the near future.

Exome sequencing in fetuses with short long bones detected by ultrasonography: A retrospective cohort study.

Background: Prenatal diagnosis of fetal short long bones (SLBs) was reported to be associated with skeletal dysplasias, chromosomal abnormalities, and genetic syndromes. This study aims to identify the genetic causes for fetal short long bones, and retrospectively evaluate the additional diagnostic yield of exome sequencing (ES) for short long bones following the use of conventional genetic testing. Methods: A cohort of ninety-four fetuses with sonographically identified short long bones was analyzed by trio-exome sequencing between January 2016 and June 2021. Fetuses with abnormal results of karyotype or chromosomal microarray analysis were excluded. Variants were interpreted based on ACMG/AMP guidelines. All diagnostic de novo variants were validated by Sanger sequencing. Results: Of the 94 fetuses, 38 (40.4%) were found to carry causal genetic variants (pathogenic or likely pathogenic) in sixteen genes with 38 variants. Five fetuses (5.3%) had variant(s) of uncertain significance. Thirty-five cases (37.2%) were diagnosed as genetic skeletal dysplasias including 14 different diseases that were classified into 10 groups according to the Nosology and Classification of Genetic Skeletal Disorders. The most common disease in the cohort was achondroplasia (28.9%), followed by osteogenesis imperfecta (18.4%), thanatophoric dysplasia (10.5%), chondrogenesis (7.9%), and 3-M syndrome (5.3%). The diagnostic yield in fetuses with isolated short long bones was lower than the fetuses with non-isolated short long bones, but not reached statistical significance (27.3% vs. 44.4%; p = 0.151). Whereas, the rate in the fetuses with other skeletal abnormalities was significantly higher than those with non-skeletal abnormalities (59.4% vs. 32.5%, p = 0.023), and the diagnostic rate was significantly higher in femur length (FL) below -4SDs group compared with FL 2-4SDs below GA group (72.5% vs. 16.7%; p < 0.001). A long-term follow-up showed that outcomes for fetuses with FL 2-4SDs below GA were significantly better than those with FL below -4SDs. Additionally, fourteen (36.8%) novel short long bones-related variants were identified in the present study. Conclusion: The findings suggest that in fetuses with short long bones routine genetic tests failed to determine the underlying causes, exome sequencing could add clinically relevant information that could assist the clinical management of pregnancies. Novel pathogenic variants identified may broaden the mutation spectrum for the disorders and contributes to clinical consultation and subsequent pregnancy examination.

Cervical HPV infection in Guangzhou, China: an epidemiological study of 198,111 women from 2015 to 2021.

Persistent high-risk human papillomavirus (HPV) infection is the pivotal cause of cervical carcinogenesis. HPV types distribution varies greatly by region, and its long-term changes of prevalence remain to be fully characterized in China. Here, the largest population of 198,111 consecutive women who underwent routine cervical screening were investigated from 2015 to 2021 in Guangzhou, south China. The results showed that the overall HPV prevalence was 21.66% (42,911/198,111), and the annual prevalence increased significantly from 2015 to 2021 (p < 0.001). HPV52, 16, 58, CP8304, 51, 53, 39, and 68 were the most prevalent HPV types. The relative HPV-positive rate correlated positively with the progression of cervical intraepithelial neoplasia (p < 0.001); HPV16 was the predominant carcinogenic type, followed by HPV52 and HPV18. HPV infections were significantly age-specific, and 26.51% (11,375/42,911) of cases were caused by multiple HPV types. In addition, HPV infections typically cleared over a median time of 16 (interquartile range 9-31) months, and the clearance of HPV16 was significantly faster than that of other types (p < 0.001). These findings may serve as a guide for local governments to evaluate HPV vaccination and cervical cancer prevention strategies in south China.

Combined fetal fraction to analyze the Z-score accuracy of noninvasive prenatal testing for fetal trisomies 13, 18, and 21.

OBJECTIVE: This study aims to evaluate the correlation combined fetal fraction and Z-score for fetal trisomies 13, 18, and 21 of NIPT by the semiconductor sequencing platform and further analyze the differences of different sequencing depths. METHODS: A cohort of 61,581 pregnancies were recruited for NIPT. Invasive prenatal diagnostic confirmation is recommended in all high-risk NIPT cases. Logistic regression and rank correlation analysis were applied to analyze the relationship between different parameters. ROC curve analysis was adopted to analyze the cutoff values of Z-score and fetal fraction. RESULTS: A total of 278 common trisomy pregnancies were verified in 377 NIPT-positive results. The fitted logistic regression models revealed that Z-scores of NIPT-positive results were significantly associated with PPVs (p < 0.05). The ROC curve analysis showed that the optimal cutoff value of Z-scores for T21, T18, and T13 was 7.597, 4.944, and 9.135 for NIPT and 9.489, 8.004, and 12.4 for NIPT-plus. If combing fetal fraction as another evaluation factor, the PPV of trisomy 21 gradually improved. We analyzed the correlation between the fetal fraction and the PPV, which revealed that the fetal fraction was significantly correlated with PPV. By analyzing the PPV of different groups divided by the associated criteria obtained from ROC curve, the PPV of high Z-score and high fetal fraction is higher in groups of Z-score > the optimal cutoff value. CONCLUSION: The results of this study show that the fetal fraction is significantly correlated with the PPV. Combining fetal fraction with Z-score is significantly better than in groups of Z-score-associated criteria; clinicians can give more accurate and efficient prenatal genetic counseling.

Deep metagenomic characterization of gut microbial community and function in preeclampsia.

Preeclampsia (PE) is a pregnancy complication characterized by severe hypertension and multiple organ damage. Gut microbiota has been linked to PE by previous amplicon sequencing studies. To resolve the PE gut microbiota in a higher taxonomy resolution, we performed shotgun metagenomic sequencing on the fecal samples from 40 early-onset PE and 37 healthy pregnant women. We recovered 1,750 metagenome-assembled genomes (representing 406 species) from the metagenomic dataset and profiled their abundances. We found that PE gut microbiota had enriched in some species belonging to Blautia, Pauljensenia, Ruminococcus, and Collinsella and microbial functions such as the bacitracin/lantibiotics transport system, maltooligosaccharide transport system, multidrug efflux pump, and rhamnose transport system. Conversely, the gut microbiome of healthy pregnant women was enriched in species of Bacteroides and Phocaeicola and microbial functions including the porphyrin and chlorophyll metabolism, pyridoxal-P biosynthesis, riboflavin metabolism, and folate biosynthesis pathway. PE diagnostic potential of gut microbial biomarkers was developed using both species and function profile data. These results will help to explore the relationships between gut bacteria and PE and provide new insights into PE early warning.

[A consensus on prenatal diagnosis and genetic counseling for chromosomal mosaicism].

With the extensive application of highly sensitive genetic techniques in the field of prenatal diagnosis, prenatal chromosomal mosaicisms including true fetal mosaicisms and confined placental mosaicisms are frequently identified in clinical settings, and the diagnostic criteria and principle of genetic counseling and clinical management for such cases may vary significantly among healthcare centers across the country. This not only has brought challenges to laboratory technician, genetic counselor and fetal medicine doctor, but can also cause confusion and anxiety of the pregnant woman and their family members. In this regard, we have formulated a consensus over the prenatal diagnosis and genetic counseling for chromosomal mosaicisms with the aim to promote more accurate and rational evaluation for fetal chromosomal mosaicisms in prenatal clinics.

Next-generation sequencing facilitates genetic diagnosis and improves the management of patients with hearing loss in clinical practice.

BACKGROUND: Hearing loss (HL) is a prevalent sensorineural disorder, and is among the most etiologically heterogeneous disorders. With the advent of next-generation sequencing (NGS) technologies, hundreds of candidate genes can be analyzed simultaneously in a cost-effective manner. METHODS: Ninety-four patients from 87 families diagnosed with non-syndromic or syndromic HL were enrolled. A custom-designed HL panel and clinical exome sequencing (CES) were applied to explore molecular etiology in the cohort, and the efficacy of the two panels was examined. RESULTS: The etiologic diagnosis for HL has been identified for 36 out of 87 probands (41.4%), 28 with an autosomal recessive (AR) inheritance pattern and 8 with an autosomal dominant (AD) pattern. Candidate variants in 18 different genes were identified in the study cohort, 10 with AR inheritance pattern and 8 with AD pattern. Fourteen of the variants identified in the study were novel. CONCLUSIONS: The custom-designed HL panel covers almost all known HL-associated genes, and can be used as an effective clinical diagnostic platform; CES evaluates all exons related to clinical symptoms, and is also suitable for clinical diagnosis of HL. Next-generation sequencing facilitates genetic diagnosis and improves the management of patients with HL in the clinical practice.

A new biomarker for the early diagnosis of gastric cancer: gastric juice- and serum-derived SNCG.

Aim: To explore the possibility of gastric juice (GJ)- and serum-derived SNCG as a potential biomarker for the early diagnosis of gastric cancer (GC). Materials & methods: GJ and serum samples were collected from 87 patients with GC, 38 patients with gastric precancerous lesions and 44 healthy volunteers. The levels of SNCG in GJ and serum samples were detected by ELISA. Results: The levels of SNCG in GJ and serum were significantly higher in the GC group when compared with the GPL group or the control group. The expression of SNCG in GJ and serum was associated with tumor node metastasis stage, lymph node metastasis, tumor size and drinking, and it is important for the diagnosis and prognosis of GC (p < 0.05). Conclusion: The findings highlight the significance of SNCG in GC diagnosis and prognosis and implicate SNCG as a promising candidate for GC treatment.

Gastric cancer (GC) has high morbidity and mortality rates due to its concealment in the early stage. At present, CEA, CA19-9, CA125, CA724, AFP, CA242 and CA50 are commonly used for the diagnosis of GC, but the effects are not satisfactory. Thus, a better biomarker for the diagnosis of GC is required. This study found that SNCG is highly expressed in the gastric juice and serum of GC patients and contributes to GC's progression. Detection of SNCG in gastric juice and serum is an ideal method for early diagnosis of GC with high specificity and sensitivity. Furthermore, SNCG has great value in the prognosis evaluation of GC, and high expression of SNCG predicts shorter survival for patients with GC, which provides a valuable reference for the clinical diagnosis and treatment of GC.

Non-Invasive Prenatal Diagnosis of Monogenic Disorders Through Bayesian- and Haplotype-Based Prediction of Fetal Genotype.

Background: Non-invasive prenatal diagnosis (NIPD) can identify monogenic diseases early during pregnancy with negligible risk to fetus or mother, but the haplotyping methods involved sometimes cannot infer parental inheritance at heterozygous maternal or paternal loci or at loci for which haplotype or genome phasing data are missing. This study was performed to establish a method that can effectively recover the whole fetal genome using maternal plasma cell-free DNA (cfDNA) and parental genomic DNA sequencing data, and validate the method's effectiveness in noninvasively detecting single nucleotide variations (SNVs), insertions and deletions (indels). Methods: A Bayesian model was developed to determine fetal genotypes using the plasma cfDNA and parental genomic DNA from five couples of healthy pregnancy. The Bayesian model was further integrated with a haplotype-based method to improve the inference accuracy of fetal genome and prediction outcomes of fetal genotypes. Five pregnancies with high risks of monogenic diseases were used to validate the effectiveness of this haplotype-assisted Bayesian approach for noninvasively detecting indels and pathogenic SNVs in fetus. Results: Analysis of healthy fetuses led to the following accuracies of prediction: maternal homozygous and paternal heterozygous loci, 96.2 ± 5.8%; maternal heterozygous and paternal homozygous loci, 96.2 ± 1.4%; and maternal heterozygous and paternal heterozygous loci, 87.2 ± 4.7%. The respective accuracies of predicting insertions and deletions at these types of loci were 94.6 ± 1.9%, 80.2 ± 4.3%, and 79.3 ± 3.3%. This approach detected pathogenic single nucleotide variations and deletions with an accuracy of 87.5% in five fetuses with monogenic diseases. Conclusions: This approach was more accurate than methods based only on Bayesian inference. Our method may pave the way to accurate and reliable NIPD.

ChromosomeNet: A massive dataset enabling benchmarking and building basedlines of clinical chromosome classification.

Chromosome karyotyping analysis is a vital cytogenetics technique for diagnosing genetic and congenital malformations, analyzing gestational and implantation failures, etc. Since the chromosome classification as an essential stage in chromosome karyotype analysis is a highly time-consuming, tedious, and error-prone task, which requires a large amount of manual work of experienced cytogenetics experts. Many deep learning-based methods have been proposed to address the chromosome classification issues. However, two challenges still remain in current chromosome classification methods. First, most existing methods were developed by different private datasets, making these methods difficult to compare with each other on the same base. Second, due to the absence of reproducing details of most existing methods, these methods are difficult to be applied in clinical chromosome classification applications widely. To address the above challenges in the chromosome classification issue, this work builds and publishes a massive clinical dataset. This dataset enables the benchmarking and building chromosome classification baselines suitable for different scenarios. The massive clinical dataset consists of 126,453 privacy preserving G-band chromosome instances from 2763 karyotypes of 408 individuals. To our best knowledge, it is the first work to collect, annotate, and release a publicly available clinical chromosome classification dataset whose data size scale is also over 120,000. Meanwhile, the experimental results show that the proposed dataset can boost performance of existing chromosome classification models at a varied range of degrees, with the highest accuracy improvement by 5.39 % points. Moreover, the best baseline with 99.33 % accuracy reports state-of-the-art classification performance. The clinical dataset and state-of-the-art baselines can be found at https://github.com/CloudDataLab/BenchmarkForChromosomeClassification.

Novel Biallelic Variant in the BRAT1 Gene Caused Nonprogressive Cerebellar Ataxia Syndrome.

Recessive mutations in BRAT1 cause lethal neonatal rigidity and multifocal seizure syndrome (RMFSL), a phenotype characterized by neonatal microcephaly, hypertonia, and refractory epilepsy with premature death. Recently, attenuated disease variants have been described, suggesting that a wider clinical spectrum of BRAT1-associated neurodegeneration exists than was previously thought. Here, we reported a 10-year-old girl with severe intellectual disability, rigidity, ataxia or dyspraxia, and cerebellar atrophy on brain MRI; two BRAT1 variants in the trans configuration [c.1014A > C (p.Pro338 = ); c.706delC (p.Leu236Cysfs*5)] were detected using whole-exome sequencing. RNA-seq confirmed significantly decreased BRAT1 transcript levels in the presence of the variant; further, it revealed an intron retention between exon 7 and exon 8 caused by the synonymous base substitute. Subsequent prenatal diagnosis for these two variants guided the parents to reproduce. We expand the phenotypic spectrum of BRAT1-associated disorders by first reporting the pathogenic synonymous variant of the BRAT1 gene, resulting in clinical severity that is mild compared to the severe phenotype seen in RMFSL. Making an accurate diagnosis and prognostic evaluation of BRAT1-associated neurodegeneration is important for reproductive consultation and disease management.